Cancer stem cell - PDFSEARCH.IO - Document Search Engine

Cancer stem cell
Results: 652

#	Item
371	Session I Update on Current Approaches and Trials MDACC EXPERIENCE Laurence J.N. Cooper, M.D., Ph.D. MD Anderson Cancer Center Add to Reading List Source URL: osp.od.nih.gov Language: English - Date: 2014-01-13 09:31:11 Stem cells Biotechnology Emerging technologies Hematopoietic stem cell transplantation Surgical oncology Complement receptor 2 Gene therapy CD19 B cell Biology Medicine T cells
372	JAX® MICE, CLINICAL & RESEARCH SERVICES Immunodeficient JAX® Mice Models Our immunodeficient suite provides Add to Reading List Source URL: jaxmice.jax.org Language: English - Date: 2014-11-28 19:59:24 Lymphocytes Model organisms NSG mouse T cells Biotechnology Nude mouse Thymus Severe combined immunodeficiency Cancer stem cell Biology Medicine Immunology
373	Hematopoietic Stem Cell Gene Therapy: Safety and Efficacy in Large Animal Studies Hans-Peter Kiem Fred Hutchinson Cancer Research Center And Add to Reading List Source URL: osp.od.nih.gov Language: English - Date: 2014-01-08 12:16:39 Biotechnology Molecular biology Cell biology Viral vector Hematopoietic stem cell Gene therapy Haematopoiesis Lymphocyte Granulocyte Biology Gene delivery Leukocytes
374	TGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGA AGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGAAGCAGATGA AGATGAAGCAGATGAAGCAG Add to Reading List Source URL: myeloma.uams.edu Language: English - Date: 2014-05-19 15:11:44 Immunosuppressants Stem cells Cancer organizations Multiple myeloma Hematopoietic stem cell transplantation University of Arkansas for Medical Sciences Multiple Myeloma Research Foundation Thalidomide Hematological malignancy Medicine Hematologic neoplasms Cancer research
375	Keyword: Part II Measures Implemented to Promote Science and Technology Add to Reading List Source URL: www.mext.go.jp Language: English - Date: 2013-01-15 03:23:36 Developmental biology Emerging technologies Cloning Cancer research Embryonic stem cell Induced pluripotent stem cell Shinya Yamanaka Cancer stem cell Regenerative medicine Biology Stem cells Biotechnology
376	Exceptional contributions to cancer research recognized at Cancer Research Conference Awards For immediate Release October 28, 2013 (TORONTO) - The Canadian Cancer Research Alliance (CCRA) announced today the recipients Add to Reading List Source URL: www.ccra-acrc.ca Language: English - Date: 2013-10-28 11:15:10 John Dick Victor Ling Cancer stem cell Institute of Cancer Research BC Cancer Research Centre Allen C Eaves Medicine Cancer organizations Cancer research
377	January 28, 2013 Stemline Therapeutics, Inc. Announces Pricing of Initial Public Offering of 3,317,644 Shares of Common Stock NEW YORK, Jan. 28, 2013 (GLOBE NEWSWIRE) -- Stemline Therapeutics, Inc., a clinical-stage bio Add to Reading List Source URL: www.athyrium.com Language: English - Date: 2013-04-28 22:02:41 Securities United States Securities and Exchange Commission Prospectus Finance Registration statement Initial public offering Cancer stem cell Stock market Financial economics Corporate finance
378	Synthetic Biology President’s Commission for the Study of Bioethical Issues  9 July 2010 Add to Reading List Source URL: osp.od.nih.gov Language: English - Date: 2014-01-13 09:35:11 T cells Lymphoma Immune system Immunology Immunotherapy Hematopoietic stem cell transplantation Cancer immunotherapy Mantle cell lymphoma Lymphocyte Medicine Biology Anatomy
379	Microsoft Word - bmtpaper20100303.doc Add to Reading List Source URL: chicagofed.org Language: English - Date: 2010-04-01 10:39:41 Oncology Center for International Blood and Marrow Transplant Research Hematopoietic stem cell transplantation Breast cancer Clinical trial Cancer and Leukemia Group B Metastatic breast cancer Chemotherapy Nelene Fox Medicine Stem cells Transplantation medicine
380	ALBERTA SCIENCE AND RESEARCH INVESTMENTS PROGRAM RESEARCH OUTCOMES 2005 Annual Report Add to Reading List Source URL: www.iae.alberta.ca Language: English - Date: 2009-05-27 10:54:11 Health Association of Commonwealth Universities Consortium for North American Higher Education Collaboration University of Alberta Diabetes mellitus type 1 Gene therapy Stem cell treatments The Centre for Applied Genomics Cancer research Biology Medicine Emerging technologies

UPDATE